After FDA issued new guidance requirements on September 7, 2006, the IVD market underwent some significant changes. The first in vitro diagnostic multivariate index assay (IVDMIA) was cleared February 13. The de novo 510(k) process cleared Agendia's (Amsterdam, The Netherlands) MammaPrint, a 70-gene breast cancer prognosis test that consists of amplifying and labeling tumor RNA, microarray capture, readout and, accompanying software analysis.¹ The results and clearance reinforce the reliability of multigene tests for breast cancer prognosis prediction, but more importantly, it says that FDA is moving forward with the guidance and is making efforts to clear such devices.

Many of the other marker tests being clinically implemented appear to fall into the IVDMIA category, for example, Oncotype DX by Genomic Health Inc. (Redwood City, CA), and the AlloMap molecular expression test from XDx Inc. (Brisbane, CA). The AlloMap is not FDA cleared, but has been implemented clinically for application to cardiac allograft recipients. The test identifies the risk of tissue damage and rejection before it occurs. Like Oncotype DX, AlloMap has also been rigorously tested. XDx plans to develop the AlloMap technology into multiple IVDMIA kits.

Following the CLIA laboratory testing route, both Genomic Health and XDx developed and performed the test in-house. This particular business model causes the most concern for FDA. However, FDA has stated it believes that good science is good science, and if patients are currently receiving tests such as IVDMIAs, then the data probably exist to show that they are safe and effective. FDA hopes this perspective encourages open communication with companies and manufacturers. Also, manufacturers need to know that the first IVDMIA clearing process was very efficient with the review total time taking less than 30 days, including classification.

Building on Success

Based on mounting scientific data and the first molecular marker IVDMIAs making headlines, IVDMIAs are analyzing fewer than 100 targets per test. Tests that use more quantitative means such as real-time PCR to attain diagnosis will require even fewer markers, possibly as few as five. On average, systems using solid supports (arrays and beads) and endpoint analysis do a relatively poor job of quantifying marker concentrations, yet have greater multiplexing capabilities. Perhaps this is why MammaPrint requires more targets per test than Oncotype DX. In a previously published IVDT article, I discussed how molecular diagnostics (nucleic acid diagnostics) can be placed into two categories: 1) solid-phase highly multiplexed analysis (e.g., MammaPrint), and 2) solution-phase quantitative analysis (e.g., Oncotype DX).²

The best technologies of the future will combine the multiplexing capability of solid-phase endpoint readouts with the quantitative nature of the real-time solution- based systems. Companies like Fluidigm (South San Francisco, CA) with real-time PCR arrays may be close to achieving this system. However, there is one major concern regarding highly multiplexed real-time systems in the clinic: the number of data points. Single-target quantitative assays require a large amount of data to obtain FDA clearance, and a submission of 1000 or more real-time assays bundled into a single IVDMIA is impractical. Until the technology becomes practical, instrument systems like the Illumina (San Diego, CA) VeraCode system or the Luminex (Austin, TX) LabMap system will likely remain the standard for years to come. To extend their molecular capabilities, Luminex recently purchased TM Bioscience. With decreased revenues due to the March 13 court decision in favor of Affymetrix, Illumina may follow Luminex's strategy and enter the IVD market by acquiring chemistry and market penetration suitable for its system.

Despite governance from FDA, the molecular market moves further ahead. FDA is taking steps to include industry representatives in the decision-making process and plans to streamline the approval process of future multiplexed IVDs. From recent public meetings, I believe their approach to be sincere, but ultimately, destiny will be in the hands of those in the ring. And that is us.

Dissolvable films can be die-cut and placed in a testing device or test strip used in immunoassays, food testing, environmental analysis, and emergency response test kits.

Dissolvable films were first introduced to consumers in 2001 as a novel breath freshener. Pharmaceutical companies quickly followed suit by developing oral strip formats of popular over-the-counter cold and antacid drugs to promote easy and accurate dosing for children and the elderly.¹ Manufacturers of cosmetic teeth whiteners, personal grooming products, and dishwashing detergents are also adopting ways to take advantage of the premeasured, single-dose benefits of dissolvable film technologies.

As IVD manufacturers explore new platform technologies, applications and cost reductions for next generation devices, dissolvable films can offer viable design and manufacturing benefits. The formulation of dissolvable films from aqueous polymer matrices across a wide molecular weight (Mw) range provides the flexibility to achieve various physical properties that can be tailored to the IVD manufacturer's specific design needs. Reagents can be integrated directly into a dry, dissolvable film that may be die-cut and placed in a testing device or test strip used in immunoassays, cell separations, food testing, environmental analysis, and emergency response test kits.

Designers can use a single dissolvable film with one or multiple reagents. Alternatively, multiple dissolvable films with one or multiple reagents may also be considered for diagnostic test devices.²

This article will review the formulation, properties, benefits, and potential applications of dissolvable films for manufacturers of diagnostic tests such as biosensors, lateral-flow devices, test strips, and test cards.

Formulating Dissolvable Films

Single-layer dissolvable films are produced by combining water-soluble components and additives to attain the desired dissolution rate of less than 60 seconds when exposed to aqueous biological and environmental fluids. Various polymers can be used if they are water soluble, impart sufficient film strength, and enable the desired film disintegration properties.3 The optimal properties of film strength and disintegration are obtained when the water-soluble components include a combination of hydrophilic polymers.

Once a homogeneous solution is formed, reagents and plymers can be added to control the film's strength and flexibility. The film can also include filler, which is a dispersed phase within the film to modify its dissolution profile. For cases in which combinations of additives are included, making the ingredients compatible with the polymer base formula can be challenging.

Other components such as starches and polysaccharides can promote or delay the film's disintegration.² Plasticizers or humectants can be added during manufacturing to increase its overall flexibility, while preventing brittleness or breakage. Thickeners, buffers, stabilizers, and other additives can also be added to deliver the desired capabilities of the product design.

Some applications may require films to demonstrate variable dissolution times in order to perform in different conditions (e.g., elevated pH), which would require altering film thickness or adding materials with different solubility parameters. Dispersed phase filler particles can be included to add bulk to the film, increase the solids portion to aid in the coating process, or alter dissolution rates with an aqueous sample. Air or other gases can also change the dissolution time. A surface energy modifier can stabilize the gaseous bubbles as a dispersed phase within a solution to allow it to be processed.

A reagent or combination of reagents that may be either soluble in the solution, suspended, or dispersed is further processed into a film by one of many casting, drawing, or extruding techniques. For example, the solution or dispersion may be roll-coated onto a release-treated paper or film substrate.

After coating the solution or dispersion onto a support surface, the solvent is removed by drying, which produces a film containing one or more homogenously dispersed reagents. In addition, reagents may be homogenously dispersed in the film during extrusion processing. The preferred range for finished films is 0.4-2.0 mil, although various thicknesses are possible to meet the needs of a particular application.

The film is wound into a roll format prior to being processed into single, measured doses of films for specific IVD devices.

As a precaution, the finished rolls of dry film are wrapped in foil packaging to ensure environmental protection during handling and storage. Exposing test strips containing dissolvable films to high humidity should be avoided since hydrophilic water-soluble polymers are used. Because IVD manufacturers process their test strips under low humidity conditions, no changes in the manufacturing environment would be anticipated.

Figure 1. After coating, the film is dried and wound into a roll format prior to being processed into single, measured doses of films for specific IVD devices.

The dry film can be further processed by any suitable technique to achieve the desired outcome for the device, including die cutting or cutting across the width of a single, narrow roll. Continuous processing of rolls containing reagents can be less wasteful than conventional processes (see Figure 1).

Physical Properties

Figure 2. (click to enlarge) Disintegration photo series: (a) start of test; (b) three seconds; (c) five seconds; (d) ten seconds.

Characteristics such as thickness, dissolution rate, surface characteristics (e.g., texture), and mechanical properties (e.g., film strength) can be tailored for dissolvable films. Such physical attributes are affected by the Mw of the water-soluble polymers in the film base. High concentrations of nonfilm-forming additives will also decrease film strength and compromise dissolution time. Consequently, there is a balance that exists between film strength and disintegration rate (see Figure 2).³

Table I. (click to enlarge) Effect of polymer selection on dissolution time. Note: Test average of n = 4; Polymer content provided as ratio.

In addition, thickness and mass play a role in determining the dissolvable film's physical properties. Constructions comprised predominantly of low-Mw, water-soluble polymers at different thicknesses will result in a range of disintegration rates and mechanical strengths. Table I illustrates the influence of Mw on film solubility. A combination of low-Mw cellulose and a low-Mw polymer reduces disintegration time. The effect appears substantial as an additional low-Mw polymer is added. The opposite effect is observed with a combination of high-Mw cellulose polymers; although they tend to impart good mechanical properties, disintegration time is increased.

Benefits of Dissolvable Films

Benefits of dissolvable films to IVD devices include the ability to do the following:

• Utilize premeasured, preservative-free single doses.
• Enable concentrated doses.
• Improve reagent stability.
• Allow efficient use of reagents.
• Enable continuous web processing.
• Increase device design options.
• Enable separation of reactive components.
• Utilize films as protective barriers to dissolve and expose active components.
• Improve cost-effectiveness.

As discussed previously, dissolvable films offer formulation flexibility for achieving the desired physical properties of an IVD's specific application. Because these cast films are manufactured in a continuous web format, they can also offer significant manufacturing and cost efficiencies.

Conventional preparation techniques for test strips such as spraying, coating, or striping can result in reagent loss, which is expensive. Such methods can also be limiting in their effectiveness to distribute active components evenly throughout a membrane or conjugate pad. Since dissolvable films are formulated as a homogeneous mixture of a film former and reagents, consistent dispersion of the active component is a benefit of such films, translating to increased yield and reduced costs.²

The coating and processing of the film product can be customized by application. For example, the film may be cut into any size or shape to fit the end design, or may be provided in a continuous reel if needed. Each die-cut film component is a premeasured, single dose that is easier and safer to handle than aqueous solutions of reagents. Higher-dose concentrations can be obtained by increasing either the loadings in the film or the film's overall mass and thickness.

Reagent-loaded dry films do not require refrigeration or preservatives. When the reagent is integrated into a film format, its increased stability results in less waste and requires fewer resources for IVD manufacturers to store and handle the fragile reagents properly.

Diagnostic Applications

Useful for many diagnostic applications, dissolvable film technologies can do the following:

• Facilitate incorporating reagents into devices such as lateral flow, microfluidics, and microplates.
• Allow controlled release of reagents through tailored dissolution rates.
• Create isolation barriers to separate components or reagents within a device.
• Enable multilayered film constructions, including vertical-flow configurations.

The unique physical properties of dissolvable films make them well suited to meet the specific design challenges of today's IVD devices. Because a reagent may be incorporated directly into the film versus being sprayed or dispensed in droplet form by conventional methods, dispersion of a reagent within a dissolvable film is more consistent in delivering accurate results. Some appropriate reagents for integrating with dissolvable film technology may include proteins, enzymes, fluorescent markers, ferro fluids, and dyes for disease detection.

For diagnostic applications requiring controlled timing of a reaction, dissolvable films can also be incorporated as isolation barriers formulated with longer disintegration rates to delay a reaction. Alternatively, the films can be used in multiple-layer constructions containing or separating one or more reagents for their controlled release when exposed to an analyte in a device. The patent application for “Disintegratable Films for Diagnostic Devices” describes several theoretical device constructions and applications utilizing dissolvable film technology.²

Reagents can be formulated directly into a dissolvable film's composition in place of the existing technique of impregnating a reagent onto an insoluble absorbent carrier. Reagents prepared by the latter technique are not readily extracted or diffused into a sample fluid because the insoluble carrier must be wetted in order for the reagents to dissolve prior to the reaction. By substituting a dissolvable film loaded with reagents in place of the coated carrier, IVD manufacturers can control analyte exposure to a reagent. Improved control and dosing of reagents becomes important in IVD devices using multiple reagents.

In test strips that measure blood glucose levels, a blood sample flows through a fluidic channel to a reaction zone where the glucose reacts with a reagent such as an oxidizing enzyme to produce a signal proportional to the glucose concentration. A dissolvable film containing the reactive components improves the stability of the reagents. In addition, a dissolvable film with reagents can improve the efficiency of the test strip manufacturing process by the continuous processing of rolls of reagents through die-cutting and reagent placement in the glucose test strip.

Multilayer Reagent Separation Constructions. Some devices may require reactants to be separated due to incompatibility or a required sequencing of reactants. In such cases, dissolvable films containing different reagents may be positioned adjacent to one another in the device on either a vertical or horizontal plane. As the sample fluid flows from one area to the next, sequential reactions can occur.

Figure 3. (click to enlarge) Dissolvable films may be loaded with reagents and utilized as a component for the conjugate pad or the area designated for capturing reagents.

Figure 3 illustrates how a dissolvable film can be integrated as part of a multilayer device to form fluidic channels for lateral-flow test strip designs. This example incorporates multiple dissolvable films, each containing two reagents for multiple reactions. This type of construction is suitable for use in hCG test strips, since multiple films are desired for the complex reactions.⁴ The first film contains an organic acid and an inorganic base, and the second film contains an organic salt and an organic amine.

Films as Barrier Layers. Some IVD devices require a controlled flow of a sample fluid from one reagent area to another, or to a designated test area in the device. If a time delay is required for a reaction between an analyte and one or more reagents, a dissolvable film can create a barrier for enabling the required reaction time. For example, a test may require saliva samples to be exposed to the first of two reagents for a period of time either to allow a reaction with an analyte or to break down the fluid to a less viscous form. In this case, a dissolvable film acts as a barrier to contain the fluid in a location of the device for a period of time. After sufficient contact time, the barrier film will disintegrate, allowing the analyte reactant or reagents to flow to a second reagent zone or detection area. The disintegration time of the dissolvable film barrier can be controlled through polymer selection, film components, and other physical properties of film.

Figure 4. (click to enlarge) By customizing disintegration times, dissolvable films may be used as barriers to control the flow of a sample fluid from one reagent to another.

Figure 4 shows how dissolvable films can function as an isolation barrier to separate various reactive components or act as a protective coating that dissolves to expose one reagent or reaction area to another. This feature would be advantageous for applications requiring a timed manual action, such as a valve release, in which multiple reactions are required. The interaction between reactive components in the device can be controlled by a choice of dissolution time and conditions, such as pH, temperature, or ionic strength.²

The use of ferro fluids such as iron oxide in IVD testing techniques, including immunoassays, cell separation, toxicity testing, food testing, and environmental analysis, has been ongoing for some time. In such assays, biochemical complexes are separated and isolated based on magnetic properties.⁵ While the use of magnetic particles in such tests is effective, it is difficult to control the concentration of such particles due to static effects of the glass and plastic containers used in conventional diagnostic techniques. Because dissolvable films offer a stable, dry reagent composition, this technology can provide IVD manufacturers with design capabilities that can mini- mize or eliminate such problems. Reagent-containing dissolvable films can be die-cut, and the reagent part can be dispensed directly into the diagnostic container or device.

Test Methods

Testing methods to characterize dissolvable films include dissolution time and film strength to assure that the dissolution rate needed for the application is met. Testing will also ensure that the films demonstrate the appropriate strength required to withstand the rigors of processing and packaging without breakage.

The disintegration test method calls for the sample to be placed in a basket that is repeatedly dunked into a fluid. The dissolution test immerses the film sample into a bath liquid that is mechanically agitated. Alternate testing methods may be developed to specifically suit the film's polymer system. Other testing methods to simulate a desired environmental influence (e.g., disintegration in varying fluid temperatures) can also be applied.

Film strength properties are measured through tensile and burst tests, which measure the force required to break or puncture the film. Tensile strength can be measured on any standard tensile tester. 

Conclusion

As IVD manufacturers evaluate ways to meet the growing demand for better, faster, and more cost-effective constructions, dissolvable film technologies should be considered as a viable component in new applications and in the evolution of existing devices into their next generation.

A proven technology in a growing number of pharmaceutical and personal care products, dissolvable films can offer advantages to IVD devices, including improved reagent stability, higher manufacturing efficiency due to continuous web processing, precise dosing, increased choice of device designs (including lateral and vertical flow), and the controlled release of reagents. The precise placement of a reagent in a dissolvable film can translate to lower costs due to reduced waste. In addition, the benefit of dissolvable film technologies to an IVD device designer is the ability to customize the polymeric base to develop a system configured for the specific performance requirements of each diagnostic application.

William Meathrel, PhD, is the medical and pharmaceutical R&D group leader at Adhesives Research (Glen Rock, PA). He can be reached at bmeathrel@arglobal.com.	Cathy Moritz is a product development chemist for the ARcare medical division at Adhesives Research (Glen Rock, PA). She can be reached at cmoritz@arglobal.com.

Measuring bacterial growth, bacterial cell viability, and antibiotic resistance is a major objective for many IVD technologies, and an important factor in human healthcare and many industrial areas such as food production, water safety, and pharmaceuticals. Traditional culture techniques for such measurements still predominate and can be extremely sensitive (e.g., a detection limit potentially as low as 1 cfu). However, they are very slow, often with culture periods of more than 24 hours depending upon the microorganism.

A number of rapid methods have been developed to provide shorter analysis times in which there is a need for rapid results.¹ Such methods include nucleic acid testing (NAT) technologies based on specific genomic DNA and RNA amplification processes (such as polymerase chain reaction (PCR) and transcription mediated amplification (TMA), which can provide fast results within a few hours. Such molecular diagnostics techniques are ideally suited for detecting and identifying specific organisms or pathogenic species. However, they do not provide accurate information on the viability of the bacterial cells present in the sample.^2,3

One approach for adding this crucial functionality has been to focus instead on mRNA as the diagnostic target.⁴ mRNA has a short half-life and disappears rapidly from the cytoplasm upon cell death. Hence, mRNA content is an indicator of the cell's viability. However, measuring mRNA for this application is not commonly used since reverse-transcriptase PCR is more complex and expensive than standard PCR processes. Moreover, mRNA can persist for long periods in dead cells, limiting the general usefulness of this technique.⁴

The alternative and most widely used nonmolecular diagnostic technique to determine cell viability is the measurement of the intracellular adenosine triphosphate (ATP) content. Such techniques employ luminescence generated by the firefly luciferase reaction and provide a quantitative measurement.^5–7 While ATP determination by luminescence is rapid, sensitive, and simple to perform, one disadvantage is that laboratories must invest in and maintain sophisticated luminescence equipment for what may be a single application.⁸

Detecting ATP

Iseao Technologies Ltd. (London) has developed a ligase-mediated ATP amplification assay (LiMA) that combines the measurement of ATP with a NAT format. This assay takes advantage of the significant improvements that have been made in NAT technologies, such as PCR and TMA, and other isothermal systems such as strand-displacement amplification (SDA). The aim was to achieve a performance comparable to the direct luminescence-based systems for ATP by substituting amplified double-stranded DNA synthesis for the photometric output signal generated by the luciferase reaction.

Figure 1. (click to enlarge) The LiMA principle.

Figure 1 illustrates the principle of the LiMA technology. DNA ligase, an ATP-requiring enzyme, is used to join two oligonucleotides in a nicked DNA substrate and create a template that can be amplified in a DNA amplification reaction.⁹ The ligase is treated with pyrophos­phate to de­adenylate the active site, leading to an enzyme that is inactive until an ATP molecule is bound that can recreate the covalent enzyme-AMP intermediate. This then leads to the generation of the intact phosphodiester backbone in the nicked substrate, forming a template for a subsequent DNA amplification process, typically PCR.

Figure 2. (click to enlarge) The conversion reagent.

The optimal approach for the most efficient use of an ATP molecule is to immobilize the deadenylated ligase and the nicked DNA substrate on the surface of a paramagnetic bead in order to provide a rate enhancement due to the proximity of the enzyme and substrate on the bead surface. This is the conversion reagent (see Figure 2). Advantages of this approach include the ability to use larger sample volumes in LiMA than the luciferase-based luminescence techniques.

Inhibitors of the NAT process that are often found to be present in the specimen can also be removed by washing the paramagnetic beads prior to amplification of the ligated substrate.^10,11 In this context, luminescent ATP assays can be affected by inhibitors of the firefly luciferase reaction, and these cannot easily be removed.¹² LiMA may have applications in situations where luciferase is sensitive to inhibitors in the sample, but ATP-dependent DNA ligase is not.

To generate the conversion reagent, a deadenylated DNA ligase by New England Biolabs (Ipswich, MA) and the nicked DNA substrate

5'GCCGATATCGGACAACGGCCGAACTGGGAAGGCGCACGGAGAGA3', 5'CCACGAAGTACTAGCTGGCCGTTTGTCACCGACGCCTA3', 5'TAGTACTTCGTGGTCTCTCCGTGC3'

were coupled to amine paramagnetic beads by Dynal AS (Oslo, Norway) using suberic acid hydroxyl succinate ester by Sigma Aldrich (Poole, UK), washed in standard phosphate buffered saline (PBS) using a magnet, and stored in PBS. This reagent is stable for more than six months at 2–8°C.

The following protocol was used for measuring ATP with the LiMA process:

• Add conversion reagent to sample (preferably in the range of 50 µl to 1 ml) and incubate for 15 minutes.
• Capture the conversion reagent using a magnet, and wash three times with PBS.
• Add the washed beads to a conventional PCR mastermix containing the double-stranded DNA intercalator dye Syber Green by Eurogentec (Seraing, Belgium).
• Proceed with real-time PCR over a 60-minute period. The Chromo4 real-time system by MJ Research Inc. (Waltham, MA) was used to measure fluorescence increase in microplate wells.

Table I. (click to enlarge) Comparison of LiMA performance with a commercially available luciferase product.

The response of the LiMA technology to ATP is linear over a wide range of ATP concentrations.¹³ Table I shows the current performance of LiMA versus a typical firefly luciferase reagent available commercially. At its current level of development, LiMA's detection limit is approximately 10–100 times higher than the firefly luciferase luminescence reaction. However, since the sample volumes can be larger with LiMA, the practical sensitivity performance with real samples is comparable between the two techniques.

Detecting Bacteria

Figure 3. (click to enlarge) Standard curve for S. aureus. The function 2exp[CtO–CtATP] is referred to as the growth index, where CtO–CtATP is the difference in cycle number when the fluorescence signal generated in the PCR crosses a predetermined threshold level. Log growth index is plotted vs. log cell number.

Figure 3 shows a standard curve for log phase Staphylococcus aureus grown in a standard culture medium. Calculated by using 2.5× standard deviation on 10 replicates of the zero standard, LiMA's detection limit ranges from 10⁴–10⁵ S. aureus cells in a sample volume of 1 ml of the bacterial culture. Using the accepted average bacterial ATP content of approximately one attomole per actively growing log-phase cell, this detection limit for bacterial cells corresponds to 10–100 fmole ATP in LiMA after cell lysis and is consistent with the detection limit for ATP (see Table I). This sensitivity performance in a sample volume of 1 ml is the same or better than the fire­fly luciferase luminescence method in bacterial cultures.^14,15

Determining Antibiotic Resistance

The following protocol was used for detecting antibiotic resistance and determining a clinically relevant minimum inhibitory concentration (MIC):

• Bacterial strains (S. aureus and P. aeruginosa) from the American Type Culture Collection with defined MICs were grown in the presence or absence of antibiotics for three hours.
• A 1-ml sample from the culture medium was lysed by adding 50 µl of 2 N NaOH containing 2% Triton X-100 and heating to 95°C for 3 minutes to release ATP, and then neutralized after 5 minutes incubation with 50 µl of 2.0 N HCl.
• A conversion reagent was added and incubated for 15 minutes.
• Conversion reagent beads were washed three times with PBS, and real-time PCR was carried out as described above.

Figure 4. (click to enlarge) Response of S. aureus to oxacillin (a) and MRSA (b).

Figure 4a shows that growth is inhibited in a sensitive strain of S. aureus by the presence of an antibiotic in the culture medium, while Figure 4b shows that the MRSA strain was resistant to the antibiotic as expected. Figure 5a shows the inhibition of growth of P. aeruginosa by gentamycin; the MIC was determined to be 0.5 µg/ml. Figure 5b shows the inhibition of growth of the same strain by ciprofloxacin; the MIC was 0.125 µg/ml. In both cases, the MIC determined by LiMA was within one growth doubling of the reported MIC for this strain.

Diagnostic Applications

Figure 5. (click to enlarge) Response of P. aeruginosa to gentamycin (a) and ciprofloxacin (b).

The LiMA technology has applications in which bacterial cell number, cell growth, and cell viability need to be determined. One of LiMA's features is the ability to access or scavenge ATP from a range of sample vol­umes, even in the 1–100- ml range. This is an advantage for LiMA over firefly luciferase–based luminescence protocols that are limited to sample volumes of 50–100 µl since there is no inherent way to design an equivalent ATP capture approach in this system (see Table I).

This feature of the LiMA technology enhances sensitivity, which is useful in applications where bacteria are present in low numbers in large volumes of fluid, such as potable or pharmaceutical-grade water, wastewater systems, and beverages, and in manufactured items such as personal care products. The bacterial ATP in such samples can be accessed directly using the LiMA technology by lysis in situ, followed by ATP capture with a conversion reagent. There is no requirement to use complex filtration systems to capture and concentrate the bacteria first.¹⁶ The LiMA process is more cost-effective in the laboratory environment than the filtration-based luminescence products for this sample type.

In the LiMA process, enzyme inhibitors and fluorescence quenchers in the sample can be washed away prior to the subsequent NAT detection process, avoiding potential problems with the amplification reaction. The DNA ligase may also prove to be more resistant than luciferase to inhibitors in the sample. This allows bacterial ATP measurements to be made in sample types (e.g., certain foods, contaminated water, blood, and urine) that could not be used with the firefly luciferase–based luminescent technologies.

Another feature of LiMA is that the system's dynamic range is higher than the firefly luciferase bioluminescence reaction. This can be an advantage when high numbers of bacterial cells are present, which could require sample dilution and re-test.

By developing an ATP measurement technology that works with conventional NAT chemistries, it is possible to combine genotypic tests for bacterial identification with phenotypic tests for viability and growth on the same instrumentation platform. The results presented in this article for determining MRSA confirm that a phenotypic antibiotic-susceptibility assay is feasible on a NAT platform.

The LiMA reagent kit is simple and cost-effective, containing the lysis reagents, the conversion reagent, and a wash buffer. The other required reagents are common NAT chemis­tries that are available from other suppliers. The total assay time for a LiMA analysis is approximately 90 minutes; the actual duration depends on the processing ability of the NAT platform. LiMA is best suited for a laboratory scenario in which there is preexisting NAT equipment, thereby avoiding further investment in luminometers or other specialist equipment. In addition, the LiMA procedure can be automated to achieve high throughput if desired.

Conclusion

It was the original intention to develop LiMA as a laboratory-only product. However, PCR lab-on-a-chip systems employing advanced microfluidics, onboard thermal cycling, and real-time/kinetic detection have developed rapidly. It is possible that a LiMA product could be developed for field use in hygiene or environmental testing (e.g., biodefense applications) as an alternative to the existing handheld firefly luciferase–based luminescence kits.16 For example, LiMA chips would be applicable in situations where high sample volumes need to be processed, environmental or industrial samples are inhibitory to firefly luciferase but not to ATP-dependent DNA ligase, or rapid near-patient assessment of a suspected bacterial infection needs to be done.

Stuart Wilson, is a founder and director at Iseao Technologies Ltd. (London, UK). He can be reached at stuart.wilson@iseao.co.uk.	Sharon Banin, PhD, is senior scientist at Iseao Technologies Ltd. (London, UK). She can be reached at sharon.banin@iseao.co.uk.	Christopher Stanley, PhD, is a founder and director at Iseao Technologies Ltd. (London, UK). He can be reached at chris.stanley@iseao.co.uk.

Nucleic acid amplification technology has fueled the growth of molecular diagnostics, the fastest-expanding IVD industry segment. Molecular diagnostic products are rapidly transforming the healthcare industry by becoming a vital and indispensable part of the treatment process. The sensitivity, specificity, and flexibility of these products make them ideal for addressing both previously existing and emerging healthcare needs.

While the polymerase chain reaction (PCR) has long been the dominant technology for nucleic acid amplification, a variety of isothermal target amplification methods have been developed as alternatives to PCR. Isothermal amplification methods include strand displacement amplification (SDA),^1,2 transcription-mediated amplification (TMA),³ loop-mediated amplification (LAMP),⁴ rolling-circle amplification (RCA),⁵ and helicase-dependent amplification (HDA).⁶ These methods allow for the possibility of developing less-complicated and less-expensive machinery than is nec- essary for PCR. Other advantages are their potential for use in point-of-care settings and the avoidance of the expense involved in licensing the many PCR and real-time PCR (RT-PCR) patents. Isothermal amplification techniques increase competition and choice in the molecular arena without sacrificing performance.

This article describes isothermal amplification platforms, focusing on the most recent of them, HDA, and discusses their potential applications, especially as a screening and diagnosis tool for hospital-acquired infections.

Established Isothermal Methods

Two of the most well-known isothermal methods have been incorporated into large high-throughput machines, TMA in the Tigris system by Gen-Probe Inc. (San Diego) and SDA in the ProbeTec system from Becton Dickinson and Co. (Franklin Lakes, NJ). These machines are specifically designed to deal with the high volume of molecular testing performed in large clinical and reference laboratories. Both systems are capable of processing a very large number of tests daily, making them most suitable for those markets, such as testing for sexually transmitted diseases (STDs), that involve very high volumes of work. Therefore, many of the isothermal molecular tests now available on the high-throughput machines are tests for STDs. These tests do not require rapid turnaround; thus, samples can be processed off-site at large centrally located laboratories. Many of the clinical laboratories in middle-tier hospitals do not have the financial resources, nor the test volume, to justify investing in these high-throughput platforms.

And as the instruments required to automate these tests involve a significant capital expense, a high test volume is essential for commercial viability when a reagent lease model is used as a means of distribution.

Another isothermal method that has been commercialized for clinical use is an isothermal signal amplification and sequence detection method called Invader developed by Third Wave Technologies Inc. (Madison, WI).⁷ This chemistry uses the structure-specific recognition and cleavage enzyme Cleavase to cut a detection probe bound to double-stranded nucleic acids as a triplex invasion fork. This assay is compatible with several detection formats, ranging from matrix-assisted laser desorption/ionization–time-of-flight (MALDI-TOF) mass spectroscopy to fluorescence detection. The manufacturer has also developed an enhanced system, the Invader Plus, that preamplifies the target sequence with PCR in order to increase the sensitivity of the assay platform. Indeed, the Cleavase reaction allows for only a millionfold amplification when used alone, and thus falls short of the sensitivity of PCR. Interfacing Invader chemistry with another isothermal amplification assay system has the potential to make the enhanced system truly isothermal.

Close to 40 assays using this technology are being commercialized. In addition, products for human papilloma virus genotyping, human genotyping, and STD identification fill an aggressive development pipeline.

Several novel methods of isothermal amplification developed more recently have the potential to play a role in advancing the use of isothermal amplification techniques in diagnostic laboratories. One is the loop-mediated amplification platform (LAMP). This technology employs a strand-displacing polymerase and from four to six pairs of primers to selectively amplify sequences from either RNA or DNA, and targets as many as six distinct regions simultaneously.⁴ LAMP products can be detected using an RT-PCR machine and fluorescently labeled primers, or by means of a turbidity detector.⁸ Unlike with RT-PCR, which uses a probe to bind to the amplified product, LAMP method specificity is ensured by the use of multiple primer sets to target multiple regions. Kits for detection of food and environmental pathogens and research-use-only (RUO) detection kits based on the LAMP method are available from Eiken Chemical Ltd. (Tokyo).

A significant drawback of this method is that primer design remains complicated. This has prevented its widespread adoption for the development of in-house assays.

Ionian Technologies Inc. (Upland, CA) has developed a very rapid isothermal amplification technology for the detection of small DNA or RNA fragments generated directly from the target nucleic acid. The amplification process uses single-strand nicking enzymes to generate oligonucleotides that feed a primer extension reaction such that alternating cycles of nicking and extension lead to exponential amplification.⁹ Amplification products are detected by a variety of methods that include liquid chromatography–mass spectroscopy, real-time fluorescence, and capillary electrophoresis detection.

Although very quick, this system lacks the specificity of PCR and of other isothermal methods owing to the lack of a detection probe. Thus, it may be of limited utility in medical diagnostics. The speed of this amplification chemistry makes it ideal, however, for sensors for biodefense applications.

Platform Limitations

Expansion of molecular diagnostics beyond the small fraction of laboratories that currently employ the technology has been hindered by a combination of the high costs associated with its adoption and the shortage of available trained labor. This has resulted in less than 10% of the capable clinical laboratories choosing to practice molecular diagnostics. Many of these labs could potentially be interested in implementing molecular diagnostic techniques if the barrier to entry were lowered to an affordable level and the available assays were also simple to perform.

Isothermal amplification platforms may be well suited to address this market need in part because of the lack of complexity in instrumentation design; thermocycling is no longer an absolute necessity. This opens the door to the use of less costly instruments, which may increase the interest of previously reluctant laboratories in implementing molecular diagnostics.

While TMA and SDA have proven to be valuable diagnostic platforms and have paved the way for the acceptance of isothermal amplification methods in clinical and reference labs, those platforms have limitations. Mainly, they are closed platforms, meaning that clinical labs can purchase a handful of FDA-cleared and RUO kits but cannot purchase general-purpose reagents (GPRs) or analyte-specific reagents (ASRs) in order to develop home-brew assays for the targets of their choice. Gen-Probe and Becton Dickinson have not chosen to commercialize GPRs based upon TMA or SDA. Therefore, PCR remains the only commercially available platform for laboratory-developed tests.

As many of the clinical labs that practice molecular diagnostics develop and validate their own assays in-house, the lack of availability of an isothermal amplification platform has prevented them from adopting alternative molecular methods for these home-brew tests. Therefore, rapid and cost-effective molecular platforms still need to be developed in order to encourage additional laboratories to venture into the realm of molecular diagnostics. This is particularly important for dealing with hospital-acquired infections, which are discussed later in this article. A timely and inexpensive screening program upon patient entry could decrease the acquisition and spread of these deadly infections.

Helicase-Dependent Amplification

Figure 1. (click to enlarge) Helicase-dependent amplification (HDA) uses an enzyme called a helicase (red oval) to separate DNA, allowing two primers (P1 and P2) to bind and DNA polymerase (green oval) to bring about subsequent amplification.

BioHelix Corp. (Beverly, MA) has developed a novel proprietary isothermal technology platform known as helicase-dependent amplification (HDA).^6,10 HDA employs essentially the same reaction mechanism as PCR, except that a helicase enzyme, rather than heat, separates the double-stranded DNA or RNA (see Figure 1). Thus, it does not require a thermocycler for amplification.

The simple reaction scheme requires a single set of specific primers to amplify a target sequence from genomic DNA. In the first step of the HDA reaction, the helicase enzyme loads and traverses the target DNA, disrupting the hydrogen bonds that join the two strands. This helicase unwinding results in the exposure of the nucleotide sequence to the primers, which then anneal. A DNA polymerase can extend the 3'-ends of each primer using free deoxynucleotides to produce two DNA replicates. Similarly to PCR, the replicates will independently enter the next cycle of HDA, resulting in exponential amplification of the target sequence.

BioHelix has incorporated the isothermal HDA platform into two product lines, HDA-Inside and IsoAmp On Demand. The former is a GPR that sophisticated laboratories can use to develop home-brew IsoAmp assays based on the HDA platform just described. Product formation can be fluorescently detected with existing instrumentation such as real-time thermocyclers—the SmartCycler from Cepheid (Sunnyvale, CA) is an example—or fluorescence monitoring incubators—the LightScanner from Idaho Technology Inc. (Salt Lake City), for instance. HDA assays are compatible with a variety of probes, as well as with double-stranded DNA binding dyes like SYBR Green.

Even though HDA is performed isothermally and does not involve thermocycling, no isothermal machine capable of real-time fluorescence detection is commercially available. However, the BioHelix GPR can be used with the equipment that a diagnostic laboratory already possesses, primarily as a less expensive alternative to a PCR-based home-brew test. The HDA platform is also being utilized to develop IsoAmp assays that can be performed in a water bath and whose products can be detected with a disposable lateral-flow device.

HDA-Inside is the first isothermal nucleic acid amplification technology capable of use for home-brew assay development. Either other isothermal amplification technologies are too complex to implement, or manufacturers have chosen not to support such applications by not selling GPR based on their platforms.

Although home-brew assays are used for a variety of diagnostic applications, including lower-volume infectious-disease testing, they are particularly useful for esoteric human genotyping applications. Many of the human genetic tests typically being performed by clinical laboratories are not FDA-cleared assays, because insurance reimbursement policies or test volumes for these do not justify the expense associated with obtaining such regulatory clearance.

Laboratories using isothermal amplification rather than PCR to perform home-brew genetic assays can thereby increase their throughput owing to the fact that amplification reactions can be incubated in an inexpensive water bath instead of a thermocycler.

Unlike viral load monitoring, for genetic testing there is no advantage to monitoring the progress of the amplification reaction during incubation; therefore, real-time detection is not necessary. A laboratory using an Idaho Technology LightScanner and a water bath consequently could perform as many as 9600 genotyping assays per eight-hour shift using 384-well plates and including three controls for each assay.

Figure 2. (click to enlarge) Schematic diagram of the one-tube reverse-transcription HDA reaction. Step 1: Complementary primers (solid black arrow) bind to input RNA (dotted line). Step 2: A reverse transcriptase (rectangle) extends the primer and generates a complementary DNA (cDNA) strand (solid line). Step 3: A helicase unwinds the DNA-RNA hybrid, creating cDNA and RNA. Step 4: Complementary primers bind to the separated RNA and DNA. Step 5: The RNA strand reenters the reaction scheme (5-1), while a DNA polymerase extends the primer bound to the cDNA and generates a daughter strand (5-2). Step 6: The helicase unwinds the DNA strands. Steps 7–9: Primers bind to the DNA strands and a DNA polymerase copies the strands, resulting in exponential amplification.

The HDA platform was originally developed for the amplification of DNA. However, the platform has been modified for use with RNA as well, by including a thermostable reverse-transcriptase enzyme. The many-stage reaction scheme for reverse-transcriptase-based HDA, briefly defined, involves the reverse transcription of the input RNA into complementary DNA (cDNA), followed by the exponential amplification of the cDNA using HDA (see Figure 2). In both reactions, the same helicase is capable of unwinding the DNA-DNA duplexes as well as the RNA-DNA hybrid, allowing for continuous cycling of both the RNA transcription reaction and the DNA amplification reaction. By contrast with many of the RT-PCR assays, the reverse-transcription and amplification reactions can occur simultaneously in the same tube at a single temperature, simplifying and accelerating the full process.

Figure 3. (click to enlarge) Real-time reverse-transcription-based helicase-dependent amplification (RT-HDA) is fast. An Armored RNA of the Ebola virus from Asuragen Inc. (Austin, TX) was used as the template for the RT-HDA reactions in the presence of EvaGreen double-stranded DNA fluorescent dye. Assays were performed in the presence (+SSB) or absence (–SSB) of thermostable single-stranded binding proteins. Reactions were performed at 65°C in an ABI 7300 thermocycler from Applied Biosystems (Foster City, CA). The green line indicates the cycle threshold (Ct).

The inclusion of amplification enhancement proteins such as single-strand binding proteins (SSBs) from extreme thermophiles can greatly enhance the speed of HDA reactions. One example of the ability of these additives to accelerate HDA is provided by assays involving the amplification of a specific sequence that targets the Ebola virus, Asuragen Inc.'s (Austin, TX) Armored RNA (see Figure 3). In the presence of Primer Navigator SSBs developed by BioHelix, the cycle threshold (Ct) value—that is, the time at which the threshold in fluorescence is crossed—for the detection of 5000 copies of RNA is 20 minutes, whereas a Ct value of 40 minutes is obtained in the absence of SSBs.

Although the exact mechanism underlying the enhancement in reaction time due to the inclusion of the SSBs is not known, it is possible that the proteins increase the processivity of the enzymes to increase the efficiency of the reaction. The real-time HDA (RT-HDA) assays whose results are graphed in Figure 3 were performed in a slow thermocycler, the ABI 7300 from Applied Biosystems (Foster City, CA), and yet the reaction time required for detecting as few as 50 copies is still below 30 minutes—that is, as fast as RT-PCR performed in a LightCycler from Roche Diagnostics (Indianapolis) or a Cepheid SmartCycler.

HDA has been used to amplify targets from bacteria, viruses, and human DNA, and is compatible with such various detection formats as gel electrophoresis, fluorescence-based real-time detection, and lateral-flow detection. The HDA-Inside isothermal amplification technology works with fluorescence-based detection devices that are currently available in diagnostic labs. Fluorescence monitoring in real time, during the amplification reaction, allows the user to measure quantitatively input nucleic acids by using an external calibration series consisting of nucleic acid targets of known concentration, just as with RT-PCR. The HDA product is potentially a cost-effective alternative that high-complexity diagnostic laboratories can employ to develop assays for any target they choose.

Target Market: Hospital Infections

A target market that may benefit from advances in isothermal amplification methods is the screening and diagnosis of hospital-acquired infections. These infections are a growing problem in the United States and Europe. The overuse of antibiotics to treat infections has had the unfortunate consequence of developing a variety of strains of drug-resistant bacteria. The mortality rate for patients that develop a hospital-acquired infection is almost 13% per hospitalization, in comparison with a rate of 2.3% for patients without a hospital-acquired infection.¹¹

Methicillin-resistant Staphylococcus aureus (MRSA), a virulent strain of S. aureus (SA), alone is responsible for more than 100,000 hospitalizations and an estimated 10,000 to 15,000 deaths every year. Avoiding this infection can save hospitals more than $20,000 per case in estimated nonreimbursable expenses, in addition to potentially saving lives.¹² Traditional culture-based diagnostics can identify this strain inexpensively, but only after 48 hours, which is too long for either preventive screening or time-sensitive diagnosis.

More recently, several rapid molecular tests, such as the GeneExpert system by Cepheid, have been developed to reduce the MRSA identification time to less than two hours; however, the required equipment is expensive, particularly for small and middle-tier hospitals. This diminishes interest in the tests' use as a screening tool. Dependence on the clinical laboratory already having a thermocycler, or being able to purchase one, is also a deterrent to initiating molecular screening. In addition, if the laboratory has not already implemented molecular testing, then specialized training for operators of the machines to perform the assays will be necessary.

At the same time, there is tremendous societal pressure surrounding the reporting of MRSA infections in hospitals that will greatly expand the need for MRSA testing. Sixteen states already have passed laws mandating reporting of hospital infection rates, and many other states have legislation pending. Therefore, an inexpensive and simple alternative for MRSA screening has the potential to be implemented by hospitals looking for a viable solution to the increasing MRSA problem.

The ability to perform molecular tests as soon as a sample arrives in the clinical laboratory is also particularly valuable in the case of the life-threatening illness Clostridium difficile–associated disease (CDAD), another hospital-acquired infection. C. difficile is one of the most common nosocomial infections encountered in hospitals. An estimated 10–12 million adults are infected with this organism each year in the United States, and about a third of them become symptomatic.¹³ The clinical spectrum of CDAD ranges from diarrhea to severe, life-threatening pseudomembranous colitis.

Although enzyme-linked immunoassays are available to detect toxicogenic strains of C. difficile, these have high false-negative rates, even in patients with severe clinical disease. The treating physician tries to compensate for this shortcoming by ordering several successive tests. However, as the toxin degrades at room temperature and may be undetectable within two hours after collection of a stool specimen, repeat testing may not always be productive.

A fecal cytotoxicity assay using cell culture also is available, but it requires a much longer processing time. Also, because it is so complex, most hospitals do not perform the assay in-house but instead ship samples out for testing at a reference laboratory. A simple, instrumentation-free molecular assay would enable hospitals to eliminate this testing problem and potentially reduce the incidence of life-threatening pseudomembranous colitis.

Using Lateral-Flow Detection

One possible solution to the challenge of creating an economical, simple-to-use molecular test is the adoption of nucleic acid lateral flow as a detection format, rather than the more complicated fluorescence detection.¹⁴ Lateral flow is a format commonly used in the point-of-care diagnostic industry for immunotesting. It can provide a simple, cost-effective, and easily interpretable format for molecular testing as well, particularly when coupled with an isothermal amplification method.

Unlike PCR, which, even when used with lateral-flow detection, requires the use of a thermocycler for the amplification reaction, HDA can be performed in a water bath or in a heat block, making it unnecessary to purchase thermocycling equipment. Nor does HDA require a brief denaturation step at 95°C to initiate the assay, as many of the other isothermal methods do. Therefore, a single water bath or heat block is the only instrumentation necessary to perform the assay.

The familiarity of the lateral-flow immunoassay format to clinical labs means that staff will not need additional training to operate a new or complicated piece of equipment. BioHelix's IsoAmp On Demand molecular analyzer enables clinical laboratories to perform rapid molecular diagnostic tests using a simple disposable nucleic acid detection device in combination with an isothermal target nucleic acid amplification platform.

The HDA assay can be taken from a water bath and placed directly inside a plastic housing that holds the closed tube and the lateral-flow strip. This allows the tube contents to be transferred to the strip in a completely enclosed format, thus preventing release of amplicons after the amplification reaction.

Figure 4. (click to enlarge) Schematic diagram of asymmetric HDA. Amplification results in the generation of multiple copies of single-stranded amplicon for probe detection.

BioHelix is developing an HDA-based assay for its molecular analyzer that targets the mecA gene from S. aureus, an indicator of methicillin resistance. As depicted in Figure 1, HDA utilizes two sequence-specific primers to amplify a targeted sequence isothermally at 65°C. In order to most effectively couple this method with lateral-flow detection, BioHelix developed an asymmetric HDA reaction method whereby a larger quantity of one labeled primer than of the other is provided in the amplification reaction (see Figure 4). This results in the generation of single-stranded amplicons that can anneal to sequence-specific DNA probes present during the reaction.

Figure 5. (click to enlarge) Detection of MRSA by asymmetric HDA was carried out with a pair of mecA gene-specific primers and genomic DNA in the presence of a biotin-labeled probe in a total volume of 50 µl. After HDA, 10 µl was applied to 2% agarose gel (upper panels). Another 10 µl of the products were applied to lateral-flow strips following incubation with a gold-conjugated antibiotin antibody (lower panels). A visible red line indicates a positive signal (*). (a) Determination of the limit of detection (LOD) of the HDA-based MRSA assay with genomic DNA from the Mu50 MRSA strain. (b)Testing the specificity of HDA-based MRSA assay in the presence of non-MRSA S. aureus (SA) cells.

A positive signal is generated by incubating the HDA reaction with a gold-conjugated antibody to the labeled probe and applying this to a lateral-flow test strip that contains an antibody to the biotinylated primer. This ensures that detection is specific for the amplified product.

The limits of detection for the HDA MRSA assay by gel electrophoresis and by lateral-flow detection can be illustrated (see Figure 5). A positive signal corresponding to the correct product can be detected in samples containing from as many as 5 × 10⁵ copies of MRSA genomic DNA down to approximately 5 copies of MRSA genomic DNA, demonstrating the high degree of sensitivity of this method. The right-hand portion of the figure shows the ability of the HDA MRSA assay to detect specifically the presence of 100 MRSA cells in samples that also contain 106 nonresistant SA cells. Discrimination of MRSA from nonresistant SA in clinical samples is critical, as MRSA is often found concomitantly with nonresistant SA in infected individuals. In the absence of any input MRSA (lane 11 in the figure), a primer-dimer artifact is generated. However, this is not detected on the lateral-flow test strip.

Conclusion

Generally, isothermal amplification methods such as those described in this article can offer a great deal of application utility and choice for both clinical diagnostics and biodefense. They lay especially strong claim to consideration in applications in which performance, equipment requirements, and cost are important factors in the selection of a molecular diagnostics platform.

Huimin Kong is the president and CEO of BioHelix Corporation (Beverly, MA). He can be reached at kong@biohelix.com.	Bertrand Lemieux is senior director of technology development at BioHelix and he can be reached at lemieux@biohelix.com.	Tamara Ranalli is manager for business development and quality system at BioHelix and she can be reached at ranalli@biohelix.com.

Patrick Balthrop is president and chief executive officer at Luminex Corp. (Austin, TX). Luminex Corp. is a life science tools and molecular diagnostics company that is focused on the development, manufacturing, and marketing of biological testing technologies for the life sciences industry. Balthrop's career experience has included R&D, commercial operations, manufacturing, international general management and intellectual property management.

Molecular diagnostics seems to be poised on the edge of an innovative revolution. Sometimes viewed as a highly specialized field of the IVD industry, molecular diagnostics currently has an opportunity to expand the menu of diagnostic tests and technologies and encourage a symbiotic relationship among physicians, patients, pharmaceutical companies, and reimbursement authorities. Recent trends in the field of molecular diagnostics have provided a unique insight into where IVD technologies might be headed.

IVD Technology editor Richard Park spoke with Patrick Balthrop, president and chief executive officer of Luminex Corp. (Austin, TX), who shared his thoughts on where he thinks the molecular diagnostics field will advance in the future. To get an idea of where molecular diagnostics is leading us, Balthrop suggests we take a look at where we've been. He also discusses the role of government funding in the diagnostics industry, the possibilities presented by decentralization, and the advantages of a cautious approach to theranostics and personalized medicine.

IVD Technology: What have been the most significant technological developments and advances in molecular diagnostics during the past few years?

Pat Balthrop: At the beginning of molecular diagnostics development, PCR and sequencing were the early innovations. Following that, the next wave of innovations were really focused on efficiency, things like high-throughput sequencing, amplification methods that improved reproducibility and sensitivity, and so on.

More recently, however, what we're seeing is indicative of the way the laboratory business, whether it's diagnostics or life science research, has evolved over the years, in that innovative companies are responding to unmet needs in the marketplace. Two areas of unmet need are primarily focused in the general categories of work-flow and multiplexing.

Such focus on work-flow and multiplexing is being driven in part by not only the need to improve efficiency and reduce labor but also the science. What I mean is the recognition that diseases often result from a variety of factors that are working simultaneously, whether they're on the protein or the molecular side.

The ability to detect or measure those factors at the same time will deliver a more accurate result and a more accurate diagnosis.

Were those various developments and advances driven by IVD companies' business demands or specific scientific breakthroughs that came through various channels of research and development?

It was a combination, but the overriding theme is that scientific advancements create the demand. The research identifies what the different mutations might be and what their clinical implications are, which creates demand and then the need to do testing more effectively and effi­ciently. This in turn drives more research, which in turn drives additional need for efficiency, and the cycle of innovation continues.

What are currently the latest trends to emerge in the molecular diagnostics area from a market or technology standpoint?

We look at the world with a particular focus on the customer. In our case, the customer is defined as the person on the lab bench who is performing the test methods. So what we're seeing is technology addressing the need to deliver better care, and, similar to that, better clinical outcomes.

A good example of that would be the market for human papilloma virus testing. Historically, that clinical question was previously answered with a pap smear. Now, that clinical question is frequently being answered by a more specific and more relevant human papilloma virus molecular diagnostics test result.

In a similar vein, IVD companies are going forward with products like the one that Luminex hopes to receive FDA clearance for soon, a respiratory viral panel, which will in effect replace viral culture and labor-intensive methods like direct immunofluorescence assay for a group of respiratory viruses.

How does an IVD company specifically identify such trends that are emerging in molecular diagnostics?

We pay very close attention to the needs of the end-user customer. We also try to see what our technologies can do for end-user customers to their benefit. Since we're a multiplexing company, we focus on test methods that are ideally suited for multiplexing.

Cystic fibrosis is a good example. The respiratory viral panel that I mentioned before is another good example.

In those areas where the end-user has a significant need to be able to provide many answers accurately and efficiently, multiplexing can address that need. Playing a major role there is the way we stay on the cutting edge. In our lexicon, the cutting edge is defined as products that can solve real problems that real customers have.

Taking on the Challenges

What are the primary obstacles IVD manufacturers encounter when delivering molecular diagnostics technologies and trying to do business in molecular diagnostics?

From a regulatory point of view, the regulatory authorities have taken a very serious look at the molecular diagnostics industry, and we expect incremental levels of regulation in the field going forward.

Financially, it's a very different question. When you ask a financial question, you're asking about both the ability to invest in R&D and, just as importantly, getting access to intellectual property. Whether that's intellectual property on the content side—meaning the markers that you're testing for—or the technology side—where intellectual property involvement frequently determines a company's ability to commercialize the particular product.

That all adds a royalty cost burden, drives up manufacturing costs, and reduces the financial incentives for the investment, which can have a significant negative effect on innovation.

But the intellectual property is what it is, so you have to deal with it. However, there's no question that the royalty stack ends up being a significant issue in terms of innovation and investment.

How do IVD manufacturers overcome such challenges, specifically having to do with development and technological issues in molecular diagnostics?

Part of it is by our own internal innovation and making sure that we have a very good and effective program dealing with the academic community, where innovation continues to flourish. This allows us to access any intellectual property or innovation that comes out of the academic community.

The regulatory challenges are a strategic issue. FDA encourages us to pay close attention to the ever-changing regulations and then respond accordingly. It's also important to remain in a frequent, open, frank, and constructive dialogue with the regulatory authorities.

Has the investment community, such as venture capital firms, become more open to providing funding and supporting companies involved in developing molecular diagnostics?

There's no question about that. The level of interest in companies or the molecular diagnostic spaces is real. It's palpable and significantly different than it was just a year or two ago. However, as the regulatory landscape changes, that interest could wane.

Interest from investors is driven by the overall economics and demographics, meaning that molecular diagnostics is perceived as an investment opportunity because it has the potential to be a solution to a lot of the problems that occur as a result of rising healthcare costs.

For all those reasons, we agree with your assessment that the investment community, including venture capital firms, are highly interested in molecular diagnostics today. However, with increased regulation, that enthusiasm could cool quickly.

Is molecular diagnostics a field more likely to be driven by traditional targets, such as infectious or sexually transmitted diseases, or is the field going to start looking more toward genetic mutations as a basis for diseases?

I would say both. Multiplexing and molecular diagnostics together achieve what can't be achieved by more-traditional methods. If you look back historically, a similar role was played by automation or detection technologies in the clinical laboratory setting to achieve what the then currently available technologies weren't able to achieve.

We see the conversion from existing technologies in areas like infectious-disease testing to molecular diagnostics occurring for the same reason, because you can get better results.

Are both of these areas, traditional targets and genetic testing for genetic mutations, going to be equally important, and will they continue moving at an equal pace into the future?

That's the way we see it currently. In the future, we anticipate that it may lean more toward genetic mutations as a basis for disease. But when you phrase the question “genetic mutations as a basis for disease,” in my mind, that eliminates things like pharmacogenetics. When pharmacogenetics turns into a real opportunity, it will likely be a molecular diagnostic application, but that is not a molecular diagnostic application as a basis for diagnosing disease.

But we see pharmacogenetics as a significant opportunity. For infectious diseases and other categories, molecular diagnostics can deliver better results, and for the genetic basis for disease in areas like inherited diseases, genetic analysis will be able to do things that traditional test methods can't do. Pharmacogenetics represents a similar technological advance. We see all of those as being significant opportunities, and we intend to let the science guide us as we respond to the market opportunities that the science dictates.

What might be the role of other clinical areas in promoting the adoption and use of molecular technologies?

Molecular diagnostics has the opportunity to integrate with other areas of the labs or other clinical areas. For example, in oncology, there's an opportunity for some convergence with the imaging technologies.

So we see some potential there. However, the major opportunity for molecular diagnostics will be that complimentary and/or replacement role I mentioned before as these different areas are identified for improvement and the never-ending search for a better answer continues.

How has the emergence of biodefense and bioterrorism concerns affected the development of molecular diagnostics?

Government funding of technology overall plays a significant role in many industries, including this one. The role that we are playing there is accessing government grants from U.S. government agencies and departments, such as the Department of Defense, the Department of Homeland Security, and the National Institutes of Health.

The work that we're doing on their behalf with those government grants also has significant application in our core market segments of life science research and diagnostics. For example, a system that would have the ability to detect multiple pathogens that might be deployed in a biowarfare setting is an innovation for government, and a scientific application that also has application in research and diagnostics.

Also, on a government-funded project, we'll have similar design and performance requirements as a platform for labs, such as small footprint, high reliability, low cost, and so on.

Diagnostics companies should continue to have the opportunity to access government grants that will address the needs of the government, but also be able to leverage that effort in their product development for their core markets.

Has the application of molecular diagnostic technologies, when applied properly, improved the effectiveness of biodefense and bioterrorism testing over the past few years?

I would say yes, and the thing to remember here is that bioterrorism testing is at its fundamental level a multiplexing problem. Testing for only one infectious agent is not enough. In order for any bioterrorism testing effort to be effective, you have to be able to detect a number of different pathogens. If you can't, and you're only detecting one or two or some finite number, then the likelihood that someone who wanted to commit such a terrible act would use one of the pathogens that you can't detect is very high.

So it's not so much a molecular diagnostics issue. In my opinion, it's a problem only multiplexing technology can solve.

Defining the Next Step

How will the continuing emergence of theranostics and personalized medicine affect the development of molecular diagnostics?

It will affect the development of molecular diagnostics in a significant and favorable way. The reason for that is because of the data that have emerged.

There are real concerns about response rates to pharmaceutical therapies in large drug classes. Drug classes, such as the oncology class, statins, or COX-2 inhibitors, have response rates that are too low. The solution to that problem—the problem in this case defined as who will respond and who won't—is a clinical and economic question that needs to be answered using molecular diagnostics.

The overriding economic considerations for the healthcare system around the world are maximizing the use of the dollars being spent and ensuring that a patient will actually benefit from an expensive therapy. So we believe personalized medicine will play a significant role in the funding and development of molecular diagnostics.

How will molecular diagnostics manufacturers contribute to the further development of thera­nostics and personalized medicine?

The role that we will play will involve partnerships with those that see personalized medicine or theranostics as a critical need and as a market for growth.

For instance, we have the opportunity to work with pharmaceutical companies in what is referred to as drug rescue. For compounds that will not otherwise make it onto the market because of adverse events and other issues, we can work closely with the pharmaceutical industry to commercialize compounds with a companion diagnostic.

At the same time, we also have the opportunity to work closely with the reimbursement authorities to develop applications that will determine whether a patient will benefit from a particular therapy—especially therapies that address chronic conditions, because of the cost of these therapies over time.

So working with the academic community, the pharmaceutical community, and the reimbursement authorities all represent significant opportunities for us. But the key to success will be a cooperative approach with those various constituencies rather than trying to do this all on our own.

There are a number of questions and issues that still need to be addressed. How do we get to the stage where theranostics becomes a reality?

That answer may best be served by history. There was a period of time when physicians and payers were not convinced that monitoring a diabetic's blood glucose was effective. They became convinced with scientific data. The net result was that every insurance company in the United States now not only reimburses, but also encourages their diabetics to monitor their blood glucose level as often as possible. Why? Because doing so produced better clinical outcomes as well as better financial outcomes, because it kept diabetics out of the hospital.

There was a period of time when medical devices such as artificial joints and stents in lieu of a coronary bypass were in the same position. But with clinical outcomes and better financial results, those were also adopted. So I am not surprised a bit that physicians and reimbursement authorities are asking questions about personalized medicine.

But if the science can be performed to identify markers that would determine whether a patient goes on statin therapy for 30 years and whether or not they'll benefit from it, and if the clinical data are powerful, physicians will respond. If the healthcare economics data are there, the regulatory authorities, the reimbursement authorities, and physicians will respond as they always have.

However, we're in the early stages, and it's a mistake to jump to the conclusion that physicians being resistant is a bad thing. I don't think physicians are resistant. I think they're skeptical, and they should be. But once the data are there for them and the reimbursement authorities, they will respond. But if the data aren't there, they won't, and they shouldn't.

Do you think it's only a matter of time to generate those results and data, and once presented to the various parties involved, they should be convinced?

I don't think anybody's going to do it for anything other than good solid reasons, which are a combination of better outcomes clinically and better outcomes financially. Assuming that both of those can be demonstrated, I think the opportunity is real.

Frankly, some of the ideas now may turn out to be bad ones. But at its core, there's a reason why fewer than 80% of people are responding to statin therapy, and only 30% of people respond to the oncology compounds. If we can tell one of these patients from the other before those extremely expensive therapies are applied, then the data should be convincing.

Looking Forward

What are Luminex's plans in the area of molecular diagnostics, and, in particular, with the acquisition of Tm Bioscience?

The acquisition of Tm Bioscience was part of the stra­tegic process that we went through as we tried to deter­mine the best way for us to maximize the opportunity in the molecular diagnostics market segment. We have used other commercial methods in the past, such as partner­ships, to access other market opportunities. But in the case of molecular diagnostics, we chose to take an approach where we will be able to control our own destiny, make our own investments, and build our own menu or suite of products.

That's gone very well. We have a good portfolio and the respiratory virus panel product that's under review at FDA now. Also, we have the opportunity to more aggressively fund research and development in Toronto and build a very compelling suite of molecular diagnostics assays with a particular focus on inherited diseases and infectious diseases in the early stages, and down the road expanding into oncology and pharmacogenomics.

So we're very pleased. The integration's gone well, and the company is on track and poised to achieve what we believe to be some pretty special things.

What new trends can we expect to see next year and in the future in molecular diagnostics? What future challenges will emerge in molecular diagnostics?

The most significant trend will be the one that may not be particularly sexy, but we think is very important: menu. One of the phrases that we use at Luminex is “menu matters,” and what that means in molecular diagnostics is that the market opportunity becomes more compelling as more tests are developed and commercialized on a particular testing platform.

That's been true in the IVD industry for a long time outside of molecular diagnostics, and it applies in molecular as well. As more applications become available on our platform, we believe that that will be driving growth.

There are also two other trends on the horizon. One is the regulatory issues we discussed earlier, and the other is decentralization.

The molecular diagnostics market will decentralize over time to a more significant degree than it has. In this instance, decentralization is defined as more tests being performed in hospital labs and regional labs, closer to the patient, rather than in large national and regional reference labs.

The reason for that is because of a number of favorable trends, including greater reimbursement, the ubiquitous availability of a platform technology, and expanded test menus that I talked about before. Up to this point, the molecular diagnostics market has been relatively centralized in a few labs. While those labs will continue to be important and will play a key role, much faster growth is occurring in those decentralized labs where they have not historically performed molecular diagnostics testing.

Is this decentralization trend due to the fact that hospital labs and perhaps even doctors' offices at the point of care are demanding that they have the ability to do molecular tests? Will there also be a growing demand for less-expensive molecular tests?

Clearly, reimbursement plays a role in the financials.

So a combination of all those factors positions the market well for decentralization in the general category of ease of use. Part of it is having equipment that's small and affordable, as opposed to a million dollars and up. Part of it is having a broad and accessible assay menu and providing the types of tests that are clinically relevant. Historically, a lot of the molecular diagnostics market has been in testing categories where things like turnaround time are less important.

For instance, an HIV viral load result or cystic fibrosis result can be processed by an offsite facility for molecular diagnosis because the turnaround time is probably not going to have a significant difference in the clinical outcome. However, for tests like the respiratory viral panel and infectious-disease assays, time-to-result becomes more important as it will affect clinical decisions. This is another factor that will position the segment well for decentralization.

A combination of menu, reimbursement, ease of use, and ubiquitous availability of affordable hardware are starting to line up, which will create an opportunity for more and more labs to start doing molecular testing.

Petra Kaars-Wiele, PhD, is based in Germany, where she is director of regulatory affairs and affiliate compliance for Europe, the Middle East, and Africa in the diagnostic division at Abbott Laboratories (Abbott Park, Il). She can be reached at petra.kaars-wiele@abbott.com

The In Vitro Diagnostic (IVD) Directive 98/79/EC, implemented seven years ago, suggests that companies do not always fully understand compliance requirements. In response, competent authorities may be required to audit such companies and take actions against noncompliances in the market. It is the responsibility of senior managers of IVD companies to ensure that their companies have sufficient resources and a corporate culture for compliance. The following is a list of the new issues that effect noncompliance reviews:

• IVD manufacturers buying in support of IVD compliance consultants in the medical device industry need to re-evaluate this practice for several significant reasons. Careful selection is necessary to find the right person for the job and to balance the investment with the output.
• First statistics of IVD vigilance reporting and noncompliances for high-risk IVD products are published. The recently published vigilance guidance will be effective December 2007.¹ IVD manufacturers may need to revise their processes or procedures to meet the authorities' expectations.
• The new chemical framework REACH, effective since June 1, 2007, is one of the recent challenges in the European Union (EU). Careful calculations and considerations by IVD manufacturers are required.
• Last year, the Norwegian regulatory body changed the national regulations. As of October 2007, the inclusion of the Norwegian language on all labelling is mandatory.
• In early 2007, two countries joined the EU: Bulgaria and Romania. Neither member is fully integrated.
• All involved parties (manufacturers, notified bodies, competent authorities, and end-users) are continuously challenged by additional or revised regulations affecting IVDs and by the growing European Union.

Noncompliances with the IVD Directive

The IVD Directive, implemented in 2000, calls for every manufacturer to adapt to the directive and all related standards. All diagnostic products sold within the European market since December 2003 should comply with these rules. However, there are doubts within the industry that all manufacturers comply with the regulation standards.

The declaration of conformity is a good indicator of compliance. Many companies do not follow the ISO standard or the Blue Guide which states all of the elements required for a compliant product.^{2, 3} After reviewing manufacturers' declarations, the following noncompliances were commonly found: no clear identification of the single product, no classification of the product according to Global Medical Device Nomenclature (GMDN) or European Diagnostic Manufacturer Nomenclature (EDMN), no information regarding the authorized representative in the European Union, no information on the applied standards, no change control procedure, and incorrect or misleading statements regarding compliance.

Performance evaluation is another area of potential noncompliance. The instructions for use (IFU) should inform the user of the assay performance. Several manufacturers of nucleic acid test (NAT) assays do not state the assay's performance in their instructions for use. It can be a real challenge to find significant samples and perform studies to specific parameters, but this is not an acceptable reason for non-compliance with the directive.

Language Barriers

Additionally, specific language requirements are rarely met in all countries. Companies are overwhelmed with the translation requirements for many different countries.

Performing translations for an IVD into more than 15 languages through a change control system is a major task. The potential for misleading or wrong translations is often underestimated. This may not lead to recalls or serious injuries, but it is a burden to the customers.

Some manufacturers decide not to translate into certain languages because the cost of doing so is not in proportion to the sales within those smaller markets. Or some companies find it is too time-consuming to complete the administration (and keep it up-to-date) to ensure that users (with the users' consent) have a suitable level of English to enable them to work with an English instructions for use; thereby leaving users and patients at a disadvantage in certain countries.

The use of harmonized symbols on labels as indicated in standard EN 980 simplifies the labelling process. Not only does it reduce the amount of text necessary for translation, but it also makes it easier for the end-user regardless of their native language. Symbols are without a doubt useful; however, they have limitations and cannot completely replace the need for translation.

Last year, the Norwegian regulatory body changed their guidance regulations. As of October 2007, all Norwegian IVD manufacturers must include the Norwegian language for all IFUs, even those products labelled “for professional use.” Manufacturers are working hard to meet these new regulations; however, the timeline is challenging as the number of pages to be translated for IFUs for tests and their systems may easily add up to several thousands.

One positive signal from Europe is the new guidance document, published in April 2007 by the European Commission, outlining the manufacturers' requirements for providing IFUs and other information of IVDs for professional users (not for self-testing devices) in a format other than paper.⁴

Sometimes small IVD companies, which may be less aware of the IVD Directive, cause problems for compliant manufacturers if they CE mark products that do not need to be CE marked (e.g., empty Petri dishes, microscope slides, centrifuges, pipettes), which are general lab equipment, unless a specific claim makes it an IVD. The compliant manufacturer then has to explain why the company is not CE marking the product and may, as a result, be excluded from tenders, even if the company is in compliance.

The labels and declaration of conformity are items that can be seen easily by users when purchasing the product or when documentation is submitted for tenders, and yet laboratory personnel are rarely trained on these topics. Often, the CE mark on the box, the IFU, and the declaration of conformity from the manufacturer (standard included with the product) are sufficient for users to accept the product has met compliance.

Supporting Guidance Authorities

Risk analysis, risk management, complaint handling, and vigilance are also difficult areas to regulate. Are users' complaints correctly documented? Is the risk analysis updated as needed? Do the residual risks outweigh the benefits of the product? Users have to rely on assessments carried out by the appointed authorities to answer these questions. They are the only institutions allowed to examine companies' procedures and thus find noncompliances. Representatives of the appointed authorities require thorough training and knowledge of the standards and their use to ensure a balanced view on potential deficiencies.

Unfortunately, competent authorities do not have sufficient resources to perform all of the compliance audits required, and the majority of products, except for Annex II products and self-testing devices, are not required to verify their full compliance with the directive. However, this should not be an invitation for manufacturers to neglect their product compliance. On the contrary, manufacturers who are investing both time and money in compliance and the continuous improvement of their products should be in support of the EU authorities performing more audits and ensuring that the “black sheep” in the market are eliminated. This is also in the best interests of all stakeholders, including users and patients.

Companies with consistent training schedules create products that reflect the manufacturer's knowledge and compliance with the IVD Directive. It is management's responsibility to not only ensure that the appropriate resources are in place, but also that there is an attitude and support for compliance within the company.

Medical Device Consultants

When employing consultants in the IVD Directive field, there are several issues that deserve close attention. Not every medical device consultant is a qualified IVD medical device consultant. The person you hire should have a good technical background in IVDs and ideally some previous experience in the IVD business. Often consultants working in their professions for many years are sometimes distant from the daily business of the IVD industry. This is particularly important since the IVD business has evolved and technology has changed dramatically over recent years.

A careful study of the consultant's career history and reference list is key. Although a background in European legislation is important, lawyers are not necessarily good IVD consultants. A former regulatory affairs professional from an IVD or medical device company is preferable to a lawyer.

It is also beneficial to check whether the consultant has published articles on IVD regulations or regularly gives presentations at conferences on IVD issues and concerns. Although consultants who meet these specific requirements may be expensive and difficult to find, it is money well spent. Consultants may only be necessary in a critical situation, such as preparing a product for compliance or verifying all activities and documentation are completed correctly when entering the EU market for the first time. Expertise must be built within a company to ensure a continuous improvement and compliance of all areas of the product—from design to market.

Vigilance Update

Recently the German competent authorities, ZLG (the German designating and notifying authority in the field of medical devices including IVD medical devices) and the IVD vigilance group of PEI (Paul-Ehrlich-Institute) published their experiences with high-risk IVDs in Europe.⁵ From 2002 until 2005, PEI received 130 incident notifications. The number increased from 22 reports in 2002 to 52 reports in 2005. The majority of the notifications came from manufacturers, and less than 20% came from users. Other authorities within European member states and proficiency-testing organizations did submit any reports.

A close look revealed that stability and sensitivity issues with the device were often the cause of the incidents. Most manufacturers (80%) did not or could not provide performance evaluation data when requested by the competent authority. Only 1% of the cases were the result of user errors. Also, 10% of all cases were not reported within the recommended 30-day time frame, including those with a potential serious risk to public health.

PEI detected one case where the common technical specifications (CTS) were not met and lacked the necessary notified body's surveillance activity. Although this statistic is only related to a limited number of IVDs, these data make it clear that there is room for improvement. Performance evaluations in accordance with the CTS requirements throughout the shelf life of the product, cooperation with the competent authorities, timely reporting of incidents or near-incidents are all areas that need particular attention from the manufacturer's side. A responsible manufacturer should also ensure that he contracts a challenging notified body. Regular product reviews are essential as part of the manufacturer's postmarket surveillance.

Communication between manufacturers and competent authorities has increased. Competent authorities also review Internet updates on postmarket surveillance from fellow regulatory authorities throughout the world. IVD manufacturers may wish to review Internet updates as well. A list of all EU competent authorities, with links to the national Web pages, is located at the following Web site: http://ec.europa.eu/enterprise/medical_devices/ca/list_ca.htm.

MedDev 2.12 revision 5, the recently published guidance document, will be effective December 2007. Two significant changes in the document include:

• Manufacturers are required to define threshold values to establish trend reports of events, which are not required to be reported, but may become necessary when passing the threshold.
• Manufacturers are required to issue field safety corrective actions to authorities for documented incidents, where customers then will be informed by field safety notices. This guidance change implies that more corrective actions are due to safety reasons. Non-safety-related field actions are therefore not required to be reported. However, this new corrective guidance is contrary to the current transposition between Germany and France, which dictates that any systematic recall is reportable, even if the recall is non-safety-related.

Manufacturers should carefully study this revised guidance and adapt their processes and procedures accordingly.

Regulating Chemicals

REACH, which stands for Registration, Evaluation, and Authorization of Chemicals, has been effective since June 1, 2007.⁶ Many IVD manufacturers may think that their products are not subject to this regulation. Although it is true that weights of less than 1 t per year do not fall under this new framework, manufacturers, importers, and downstream users are required to comply with the regulation. Sulphates, phosphates, sodium chloride, sucrose or Triton are some of the common chemicals used in IVDs. These materials may add up throughout the year, and a careful calculation is required if the limit of 1 t is exceeded.

Companies have until June 1, 2008, to complete a pre-registration to fall under the 11-year transition period that ends in 2018. Chemicals that may contain carcinogenic compounds, alter genetic material, or compromise reproduction (i.e., CMR chemicals) must receive a complete authorization, which may require that the chemicals' use be limited or stopped. Hazardous materials like CMR chemicals will be evaluated until 2014. Seven years is sufficient time to change the product design and switch to more biologically safe ingredients. IVD manufacturers may also consider buying their chemicals in Europe to benefit from the possibility that the chemical producer completes the product registration, evaluation, and authorization in-house.

Future Harmonization

Bulgaria and Romania joined the EU at the beginning of 2007; however, neither country is fully integrated. Both nations have not fully adapted the IVD Directive into their national laws and still require local processes to be completed. Unfortunately, they are not alone as there are other EU members (e.g., Poland, Italy) that are still performing their own activities and are not fully aligned.

As long as the EU community continues to grow, it is unlikely that the authorities will have the opportunity to harmonize their processes. Until this harmonization is successful, the discussion of a centralized European regulatory body will continue.

The European IVD regulatory system is a qualified guidance organization, but it requires a lot of discipline by competent authorities, notified bodies, and manufacturers. It is unclear if it will take another seven years for the system to achieve its goals, but it is certain that all involved parties are continuously challenged by additional or revised regulations affecting IVDs.

A partnership between a leading molecular diagnostics company and a major pharmaceutical company could help to promote further acceptance of personalized medicine. Celera (Rockville, MD) entered into a research collaboration with Merck & Company, Inc. (Whitehouse Station, NJ) to develop biomarker and pharmacogenomic tests for cancer patients. Under the terms of the agreement, Celera will evaluate the use of certain gene expression profiles identified by Merck, with the goal of developing diagnostic predictors for use in Merck's clinical trials. Such predictors could potentially form the basis for commercial companion diagnostic tests for oncology therapies.

Celera will receive an undisclosed payment for this collaboration. The company would be eligible for an additional payment if Merck decides to transfer a Celera validated gene expression assay to a clinical reference laboratory upon completion.

Celera's close ties with Merck are not new. According to Celera officials, the company's relationship with Merck has unfolded over a long period of time. Celera has had a long-standing, multiyear exchange of information with Merck, which resulted in this research collaboration.

“The decision to pursue this collaboration is a reflection of the evolution and maturation of targeted medicine in which companies are developing diagnostic kits for clinical trials for various drugs,” says John Sninsky, PhD, vice president of discovery research at Celera. “So the time was right from the standpoint of matching up the drugs that Merck wanted to consider in the context of a relationship with capabilities and information that was available scientifically for a potential companion diagnostic.”

Celera officials said that one of the initial goals of the research collaboration is to gather information on messenger RNA levels that are associated with drug response. “Merck has done a large amount of work from a standpoint of messenger RNA profiling,” says Sninsky. “They have a long history of an investment into fundamental science, and they have the necessary information to take the next step and gather the information.”

The companies will focus their research efforts in oncology, which reflects cancer's importance as a clinical area and the compelling science in this area that merits being followed up on by a more directed effort.

“In a general context, oncology has really led the way, whether it be for combination therapies or combining molecular markers with drug therapies,” says Sninsky. “Certainly there are examples, such as the use of Gleevec pairing up with IVDs in a very targeted way. From my perspective, the reason oncology is first is because it is the most active area in combining genomic information in a way that will further enhance our understanding and use of drugs.”

The agreement between Celera and Merck demonstrates the importance of such collaborations in developing personalized medicine's full potential. For example, the discrete nature of the information that is available to pharmaceutical companies relative to diagnostics companies is being appreciated more. In the context of companion diagnostics, it is important to bring such knowledge bases together to go forward, since each of them separately does not have sufficient information to develop a clear and comprehensive strategy for targeted medicine. However, Celera officials believe that in order for personalized medicine to gain greater acceptance, IVD companies must do their part by conducting the proper research and presenting the appropriate data.

“IVD companies have to make a commitment to presenting timely, replicatable science,” says Sninsky. “In the end, that's what's going to convince patients, clinicians, and the reimbursement community that personalized medicine can help make the right decisions. So it's an understanding of fundamental science, and it's a gathering of compelling, statistically significant data.”

Other Celera officials added that IVD companies will also have to do a better job in educating pharmaceutical companies on the time that it takes to develop companion diagnostics products. “Very often, I get the impression that pharma companies only focus on drug development,” says Andrew Grupe, PhD, senior director of pharmacogenomics and director of central nervous system discovery research at Celera. “They don't think about the development of a diagnostic product right away. So they need to keep in mind that it takes time to develop an IVD product that they may need at the same time when they get FDA approval.”

In other related developments, Celera signed an agreement to acquire substantially all of the assets of Atria Genetics (South San Francisco, CA) for approximately $33 million in cash. Atria has a line of human leukocyte antigen (HLA) testing products that are used for identifying potential donors in the matching process for bone marrow transplants.

Since January 2004, Atria's HLA sequencing-based typing products have been marketed and distributed worldwide by Abbott Molecular (Pleasanton, CA) through its alliance with Celera. With this acquisition, Celera will retain 60% of these end-user revenues under the current distribution agreement with Abbott, and will also continue to receive a low, single-digit-percentage royalty on the total end-user revenues.
 

This past summer, a Shanghai court fined a Chinese businessman 400,000 yuan ($53,000) and sentenced him to 3½ years in prison for producing fake versions of the OneTouch brand of diabetes testing supplies, a product of LifeScan Inc. (Milpitas, CA), a Johnson and Johnson company.

LifeScan announced in October 2006 that it discovered counterfeiters were distributing the imitation test strips. Complaints about faulty results last year in September led to the discovery. These test strips, which are used to help monitor blood sugar levels of people with diabetes, produced erratic results according to LifeScan, and as a result, testers could give themselves life-threatening amounts of insulin. No known cases of injury or death were associated with the use of these counterfeit products, though certainly both were possible.

According to U.S. federal court documents, about 1 million counterfeit OneTouch test strips had been distributed throughout Canada, Greece, India, Pakistan, the Philippines, Saudi Arabia, Turkey, and in at least 35 U.S. states. In China, Su Zhiyong (alias Henry Fu) sold the strips through Halson Pharmaceuticals, a company with an Internet site, according to Bloomberg and USA Today, which pointed to a nonexistent physical address in Shanghai. Internet sites are increasingly common ways for counterfeiters to front covert operations.

Although specific data about the scope of counterfeiting relating to medical devices are unavailable, counterfeit medical devices, which have also included intraaortic pumps, stethoscopes, and sphygmomanometers, and increased counterfeiting sophistication have elevated the problem to a major public health concern.

While FDA has placed global notices warning about counterfeit tests on its Web site, those inside the organization are staying tight-lipped. According to Karen Riley in FDA's Office of Public Affairs, the agency is unwilling to provide interviews “on matters about China, because of ongoing negotiations with that country.”

“Counterfeiting is something we take very seriously,” says Dave Detmers, director, communications, at LifeScan. “While obviously we can only pursue civil suits and we do, we cooperate fully and support criminal investigations. We are certainly cooperating with the Chinese government and we are very grateful for their diligent effort on this.”

In fact, with the recent landslide in product recalls of goods manufactured in China for everything ranging from leukemia drugs to Barbie dolls, consumers are wisely taking a step back. The Chinese government is well aware of the effects of consumer perceptions on trade relations between the United States and China.

At a news briefing in August in response to the backlash against Chinese products, Kuang Weilin, deputy consul general, Consulate General of the People's Republic of China in New York, said, “the [Chinese] government is really serious, and you will see concrete results by the end of this year.” For example, regulators will block food without a safety label from export.

While there are no known incidences of injury or death resulting from the counterfeit blood glucose tests, the possibility has medical device and pharmaceutical manufacturers on their toes.

According to Aniruddha Railkar, PhD, an anticounterfeiting expert, companies are taking steps to combat counterfeit medical products. Railkar says that “educating the customer about counterfeiting and incorporating multiple levels of anticounterfeiting measures into the drug or device” are key strategies, adding that collaborations between pharmaceutical companies, wholesalers, distributors, doctors, pharmacies, governmental agencies, and global organizations such as WHO can effectively solve these problems. Collaborations such as IMPACT help to ensure accountability, since taking swift and dramatic action makes counterfeiting less attractive.

“We are not aware of and we do not believe that there are any counterfeit products currently for sale in the United States,” Detmers emphasizes. As a safety measure, LifeScan continues to conduct ongoing surveillance audits of product on pharmacy shelves. “We haven't encountered any counterfeit products for several months. However, we will keep the notices posted, as these products could still be in medicine cabinets,” Detmers says.

Prevention is important, Detmers says. Just like at the U.S. Mint where they continually alter processes to prevent counterfeiting, companies must remain dynamic and incorporate product features that consumers can distinguish easily, but which manufacturers can regularly change. “We want to make counterfeiting as unprofitable, undesirable, and risky as possible,” says Detmers.

“The degree of risk and consequence is very great,” Detmers concludes. “It takes it to a whole new level when you are talking about healthcare products.”
 

The worldwide market for molecular diagnostics testing products was estimated to be approximately $17.9 billion in 2006. According to a report by Kalorama Information (New York City), “Molecular Diagnostics: Major World Markets,” by 2016, this market is expected to reach more than $92.1 billion, with an average annual growth rate of 41.5%. The United States is projected to account for half of that market with $46.2 billion in revenues.

The molecular diagnostics segment with the largest market is currently infectious-disease testing. This is due to the fact that infectious diseases present a major market opportunity in terms of incidence and that the genetic information required for identifying pathogens is readily obtained from the bacterial and viral species involved. Molecular diagnostics for infectious diseases is expected to grow at an average annual rate of 3.69% and reach almost $12.4 billion in 2016.

The molecular diagnostics segment with the second-largest market is pharmacogenetic testing. This segment is projected to sustain an explosive average annual growth rate of 184%. Such growth is based on new discoveries in the field of mental health and the relationship of the genetic signatures of neuropsychiatric disorders to optimal treatment procedures. By 2016, pharmacogenetic testing is expected to generate revenues of $60.8 billion.

The second-fastest-growing molecular diagnostics segment is oncology testing. While oncology currently represents the smallest market segment in molecular diagnostics, it is projected to grow at an average annual rate of 68%, bringing its size to more than $9.8 billion in 2016. Using molecular diagnostics for cancer diagnosis and management will fuel this tremendous growth, based on emerging information from functional genomic studies.

Gene and chromosome testing currently represents the third-largest molecular diagnostics market segment. At this point in time, most genetic testing is prenatal testing for assessing clinically suspect newborns for various chromosomal abnormalities. Gene and chromosome testing is expected to grow at an average annual rate of 11.2% and reach $5.3 billion by 2016.

Additional information about this report can be accessed via Kalorama Information's Web site at www.kaloramainformation.com.
 

In August, FDA updated the labeling for the ubiquitous blood-thinner warfarin to include genetic testing information, saying the information can help physicians determine the safest starting dose for their patients.

A month later, the agency approved a genetic test made by Nanosphere Inc. (Northbrook, IL) that can reveal which patients have some variations in two genes, CYP2C9 and VKORC1. Clinical studies have shown that patients with variations in those genes may need a lower dose of the anticoagulant, which is sold under the trade name Coumadin by Bristol-Myers Squibb (Princeton, NJ) and in other generic forms.

This was not the first time that genetic information has been cited in prescription drug labeling. It can be found in a handful of other labels, including the oncology drugs irinotecan for colon cancer and 6-mercaptopurine for acute lymphatic leukemia.

However, this is the first time that pharmacogenomic information has been included in a drug as widely used as warfarin. It is estimated that between 300,000 and 500,000 new prescriptions for warfarin are written every year, while between 2 million and 5 million people are taking the drug every day.

Larry Lesko, PhD, director of the office of clinical pharmacology at FDA's Center for Drug Evaluation and Research (CDER), said the agency's updating warfarin labeling was significant because “it means that personalized medicine is no longer an abstract concept, but has moved into the mainstream where it is recognized as a factor in a product used by millions of Americans.”

FDA stopped short of saying that physicians must perform genetic tests before prescribing warfarin. FDA needs more definitive information to make it a directive, said Dwaine Rieves, MD, acting director of the division of medical imaging and hematology products at CDER.

However, Rieves agreed that FDA's move signifies that personalized medicine is clearly on its way. “We are at the early stages of the use of these types of tests in clinical practice…and it represents an exciting chance,” he said.

Richard S. Schifreen, PhD, vice president of research products at Mirus Bio Corp. (Madison, WI), also sees the regulatory agency's move as helping to accelerate the acceptance of companion diagnostic tests. “It is one in a series of steps that FDA has taken to encourage the IVD industry to develop companion diagnostics that will assist physicians in identifying patients most likely to benefit from a particular drug,” he said.

Schifreen expects that including pharmacogenomic information in the labeling for a drug as commonly prescribed as warfarin will also create new markets for such testing.

Schifreen added that it is interesting that FDA is in the forefront of this issue, while the pharmaceutical industry has been reluctant to embrace the new model. Still, he said, “I continue to believe that personalized medicine, including companion diagnostics, will improve medical care and will ultimately be adopted. It will just take more time than initially expected.”

Some industry observers also believe that even though the updated labeling is not a directive, its being there will encourage many physicians to include the genetic component in their initial dosing decisions.

Emily Winn-Deen, PhD, vice president of strategic planning and business development at Cepheid (Sunnyvale, CA), said determining proper dosing for warfarin is not easy, so she suspects “many physicians will be willing to adopt something that gets them to the right place faster.”

Winn-Deen also said that medical liability could be a factor. “If this labeling is in the drug, and a patient has a bleed or a clot because his physician had not gotten to the right dose quickly enough, the physician could fear he may have some liability.” They may order the genetic test to cover themselves, she said.

However, others believe FDA has moved too quickly and without sufficient evidence to support including genetic testing information in warfarin's labeling.

Ann K. Wittkowsky, PharmD, director of anticoagulation services at the University of Washington Medical Center (Seattle), said pharmacogenics is “a fascinating science,” and “one that holds a lot of promise.” However, she said, “it's just a bit premature to suggest there's a purpose for it in clinical medicine right now.”

Wittkowsky said that physicians are not likely to embrace the recommendation until a prospective, randomized trial comparing traditional dosing with genetic-based dosing is completed, and they can clearly see which method is best.